mass spectrometry raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
Reviewed 2025-11-10. Anything still debated is marked as such rather than presented as settled.
Structurally, Melanotan-2 retains the core recognition motif of alpha-melanocyte-stimulating hormone while adding a lactam bridge that links two side chains and constrains the molecule into a ring. This modification lowers susceptibility to enzymatic degradation. The compound acts as an agonist at melanocortin receptors, particularly subtypes associated with melanin production. Because the same receptor family influences several physiological processes, researchers note that its activity is not confined to pigmentation alone. Receptor selectivity continues to be examined in published studies.
Melanotan-2 is a synthetic cyclic heptapeptide designed as an analogue of alpha-melanocyte-stimulating hormone, a naturally occurring peptide involved in pigmentation signalling. Its sequence incorporates modified residues that increase potency and extend biological activity relative to the native hormone. The compound binds receptors of the melanocortin family and is examined mainly in laboratory research. It does not occur naturally and exists only as a manufactured chemical entity produced by solid-phase synthesis.
Regulatory status differs by country, and in many places supplying the compound for human consumption is unlawful. Vendors frequently label material as intended for research use only, a designation that shifts stated purpose but does not create a legal pathway for personal use. Certificates of analysis accompanying such products vary widely in detail and provenance. Third-party testing exists but is voluntary, and results are rarely linked to a specific lot in a publicly verifiable way.
Identity testing for a synthetic peptide relies on several complementary methods. Reversed-phase high-performance liquid chromatography separates the target from related impurities and reports purity as a percentage of total peak area. Mass spectrometry confirms molecular mass and can reveal deletions or truncations. Amino acid analysis and peptide mapping provide sequence-level confirmation, while counter-ion content and residual solvents are measured separately. A purity figure alone does not establish identity, so a complete dataset combines chromatographic and spectrometric evidence.
| Property | Value | Notes |
|---|---|---|
| Molecular formula | C50H69N15O9 | Synthetic cyclic heptapeptide |
| Molecular mass | Approximately 1024 g/mol | Depends on counter-ion content |
| Appearance | White to off-white powder | Commonly supplied as a lyophilised solid |
| Solubility | Freely soluble in water | Also dissolves in common aqueous buffers |
| Typical storage | -20 degrees Celsius, desiccated | Protect from light and repeated freeze-thaw |
The compound emerged from research programs in the 1980s that examined analogues of alpha-melanocyte-stimulating hormone for pigmentation and photoprotection. Investigators modified the native sequence to extend activity duration and potency. A related analogue, afamelanotide, was developed within the same broad line of inquiry and eventually gained approval in certain jurisdictions for a rare light-sensitivity condition. Melanotan-2 itself did not progress through the same regulatory route and has no approved therapeutic indication.
Melanocortin receptors comprise five subtypes with distinct tissue distributions and functions. Melanotan-2 is described in the literature as a non-selective agonist that engages several of these subtypes, including MC1R, MC3R, MC4R, and MC5R. MC1R is the subtype most directly linked to melanin production in skin cells. Because the compound is not subtype-selective, its observed effects in experimental settings are generally attributed to activity across multiple receptor pathways rather than to a single target.
Melanotan-2 is a synthetic linear peptide built from seven amino acids arranged in a short chain. Its sequence is commonly written as Ac-Nle-Asp-His-D-Phe-Arg-Trp-Lys-NH2, which includes a modified N-terminus and an amidated C-terminus. The molecule belongs to the melanocortin family and acts as a receptor agonist. Structural features such as the D-phenylalanine residue and the Nle substitution are associated with increased stability against enzymatic degradation relative to the natural parent peptide.
Lyophilised melanotan-2 is supplied as a solid, which is more stable than a solution. The material is hygroscopic, so weighing is done quickly, in low humidity, with the container kept sealed. Reconstitution usually uses water for injection or bacteriostatic water, added down the wall of the vial to limit foaming. A reconstituted solution is held at 2 to 8 °C and kept away from light. Repeated freezing and thawing of the same vial is avoided because ice crystal formation and concentration effects degrade the peptide.
Reversed-phase high-performance liquid chromatography is the routine method for purity assessment. Peptides absorb near 214 nm because of the peptide bond, and a gradient of acetonitrile in water separates the intact peptide from deletion sequences, oxidised products, and earlier-eluting fragments at neutral pH. Electrospray ionisation mass spectrometry provides an orthogonal check: the measured mass must agree with the theoretical value. Amino acid analysis and peptide mapping confirm structure but are used less often. Reference standards remain scarce because the peptide is not described in any pharmacopoeia.
Activity is attributed to agonism at melanocortin receptors, particularly MC1R and MC4R. Activation of MC1R on melanocytes increases melanin synthesis, which underlies the reported tanning effect. MC4R engagement in the central nervous system is linked to appetite suppression and to effects on sexual arousal reported in early clinical studies. Those studies were small and were not designed to establish efficacy or long-term safety. Receptor selectivity among the melanocortin subtypes is not absolute, which complicates attribution of any effect to a single pathway.
Regulatory treatment varies between countries. Several national medicines agencies have classified the peptide as unapproved, and customs authorities in some jurisdictions seize shipments on that basis. A few jurisdictions channel supply through prescription-only frameworks that do not list the substance by name. Because the material circulates mainly through online vendors, composition and purity are rarely verified before sale. Surveys of unapproved peptide products have reported labels that did not match measured content in a substantial fraction of samples.
Melanotan II is a synthetic cyclic heptapeptide analogue of alpha-melanocyte-stimulating hormone, a naturally occurring peptide involved in pigmentation signalling. Its structure substitutes a lactam bridge between side chains to increase stability relative to the native hormone. The compound is also known by the shorthand MT-II and by several non-proprietary synonyms used in research catalogues. It is not an approved therapeutic product in any major jurisdiction; material sold under this name is typically offered as a laboratory reagent rather than as a medicine.
Regulatory status varies by jurisdiction, and the substance is frequently described as unapproved for therapeutic use. Some authorities classify it alongside prescription-only medicines or controlled categories, while others address it through general consumer protection rules. Analytical surveys have reported mismatches between label claims and measured content in products sold online, although the scope of such testing is limited. Whether these discrepancies are widespread remains an open question. Discussion in the literature therefore tends to combine chemistry, supply-chain observation and policy analysis.
The material is commonly handled as a lyophilized powder in sealed vials. The solid dissolves readily in water and in polar organic solvents, producing a clear solution after reconstitution. Light, heat and repeated freeze-thaw cycles are the concerns most often raised in handling guidance, because peptide bonds and the constrained ring can degrade. Working solutions are generally prepared fresh, and material left in solution is treated as less stable than the dry form. These properties shape how laboratories store and aliquot reference material.
Identity and purity are assessed mainly by reversed-phase high-performance liquid chromatography with ultraviolet detection, often paired with mass spectrometry. Retention time supports identity, while the mass spectrum confirms the molecular weight of the intact peptide. Purity is frequently reported as a percentage of total peak area, a figure that depends on the wavelength, column and gradient used. Impurity profiling may also look for truncated sequences, oxidised forms and residual counterions. Amino acid analysis and peptide mapping provide orthogonal confirmation when required.
== Places == Central provinces (disambiguation) (C.P.) Central Provinces (1861–1936), a former province of India, succeeded by Central Provinces and Berar (1936–1950), corresponding to Madhya Pradesh in the post-partition republic Central Provinces and Berar Circuit or C. P.-Berar Circuit, a Hindi film distribution circuit comprising parts of Madhya Pradesh, Chhattisgarh and Maharashtra Clipperton Island, a territory with exceptional country code CP
Union leaders in the Congress of Industrial Organizations (CIO) vigorously campaigned for Truman in the 1948 election based upon a (never fulfilled) promise to repeal Taft–Hartley. Truman won, but a union-backed effort in Ohio to defeat Taft in 1950 failed in what one author described as "a shattering demonstration of labor's political weaknesses".
Although many mechanisms have been proposed, no definite model accounts for the mechanisms of chronic arsenic poisoning. The prevailing events of toxicity and carcinogenicity might be quite tissue-specific. The current consensus on the mode of carcinogenesis is that it acts primarily as a tumor promoter. Its co-carcinogenicity has been demonstrated in several models. However, the finding of several studies that chronically arsenic-exposed Andean populations (as most extremely exposed to UV-light) do not develop skin cancer with chronic arsenic exposure, is puzzling.
== Pros and cons == The major advantage for reverse vaccinology is finding vaccine targets quickly and efficiently. Traditional methods may take decades to unravel pathogens and antigens, diseases and immunity. However, In silico can be very fast, allowing to identify new vaccines for testing in only a few years. The downside is that only proteins can be targeted using this process. Whereas, conventional vaccinology approaches can find other biomolecular targets such as polysaccharides.
Forensic chemistry is the application of chemistry and its subfield, forensic toxicology, in a legal setting. It involves the identification, analysis, and interpretation of substances such as drugs, toxin, accelerants, and unknown materials recovered from crimes scenes or biological samples. A forensic chemist can assist in the identification of unknown materials found at a crime scene. Specialists in this field have a wide array of methods and instruments to help identify unknown substances. These include high-performance liquid chromatography, gas chromatography-mass spectrometry, atomic absorption spectroscopy, Fourier transform infrared spectroscopy, and thin layer chromatography. The range of different methods is important due to the destructive nature of some instruments and the number of possible unknown substances that can be found at a scene. Forensic chemists prefer using nondestructive methods first, to preserve evidence and to determine which destructive methods will produce the best results. Along with other forensic specialists, forensic chemists commonly testify in court as expert witnesses regarding their findings. Forensic chemists follow a set of standards that have been proposed by various agencies and governing bodies, including the Scientific Working Group on the Analysis of Seized Drugs. In addition to the standard operating procedures proposed by the group, specific agencies have their own standards regarding the quality assurance and quality control of their results and their instruments.
Sources: en.wikipedia.org
==== Policies ==== Mental health policies in the United States have experienced four major reforms: the American asylum movement led by Dorothea Dix in 1843; the mental hygiene movement inspired by Clifford Beers in 1908; the deinstitutionalization started by Action for Mental Health in 1961; and the community support movement called for by The CMCH Act Amendments of 1975. In 1843, Dorothea Dix submitted a Memorial to the Legislature of Massachusetts, describing the abusive treatment and horrible conditions received by the mentally ill patients in jails, cages, and almshouses. She revealed in her Memorial: "I proceed, gentlemen, briefly to call your attention to the present state of insane persons confined within this Commonwealth, in cages, closets, cellars, stalls, pens! Chained, naked, beaten with rods, and lashed into obedience...." Many asylums were built in that period, with high fences or walls separating the patients from other community members and strict rules regarding the entrance and exit. In 1866, a recommendation came to the New York State Legislature to establish a separate asylum for chronic mentally ill patients. Some hospitals placed the chronic patients into separate wings or wards, or different buildings. In A Mind That Found Itself (1908) Clifford Whittingham Beers described the humiliating treatment he received and the deplorable conditions in the mental hospital.
== Labeled expiration date versus true expiration == Manufacturers print expiration dates on drug bottle labels. The labeled expiration date is a manufacturer's promise for a time until which the drug will have full efficacy and be safe as manufactured. The labeled expiration date is not an indication of when a drug has become ineffective or unsafe to use. Many drugs are effective for years after their expiration dates. However, it is difficult for anyone including researchers and physicians to find information to verify how much any given drug will degrade in efficacy or become unsafe over time. Drug manufacturers never support the use of drugs after the expiration date because that could make them liable if something went wrong. The expiration date printed on drug packaging will differ from the date when the drug will become ineffective. Before the true expiration of a drug, its active ingredient will retain its potency. Also before expiration, no components of the drug will degrade to become harmful. Since products continually change over time, the characteristics of any drug are not unchanging but instead estimated with assay measurements to be within the specification required by the government regulator where the drug is sold. As a general estimate, a drug is deemed to be unfit for use when 10% of the active ingredient is degraded. Before choosing an expiration date to print the manufacturer must decide a true expiration date.
Site-specific recombination makes use of phage integrases instead of restriction enzymes, eliminating the need for having restriction sites in the DNA fragments. Instead, integrases make use of unique attachment (att) sites, and catalyse DNA rearrangement between the target fragment and the destination vector. The Invitrogen Gateway cloning system was invented in the late 1990s and uses two proprietary enzyme mixtures, BP clonase and LR clonase. The BP clonase mix catalyses the recombination between attB and attP sites, generating hybrid attL and attR sites, while the LR clonase mix catalyse the recombination of attL and attR sites to give attB and attP sites. As each enzyme mix recognises only specific att sites, recombination is highly specific and the fragments can be assembled in the desired sequence. Vector design and assembly Because Gateway cloning is a proprietary technology, all Gateway reactions must be carried out with the Gateway kit that is provided by the manufacturer. The reaction can be summarised into two steps. The first step involves assembling the entry clones containing the DNA fragment of interest, while the second step involves inserting this fragment of interest into the destination clone.
Activation is achieved through an interacting protease cascade involving plasmin and stromelysin 1 (MMP-3). Plasmin generates active MMP-3 from its zymogen. Active MMP-3 cleaves the propeptide from the 92-kDa pro-MMP-9, yielding an 82-kDa enzymatically active enzyme. In the active enzyme a substrate, or a fluorogenic activity probe., replaces the propeptide in the enzyme active site where it is cleaved. The catalytic domain contains two zinc and three calcium atoms. The catalytic zinc is coordinated by three histidines from the conserved HEXXHXXGXXH binding motif. The other zinc atom and the three calcium atoms are structural. A conserved methionine, which forms a unique “Met-turn” structure categorizes MMP9 as a metzincin. Three type II fibronectin repeats are inserted in the catalytic domain, although these domains are omitted in most crystallographic structures of MMP9 in complex with inhibitors. The active form of MMP9 also contains a C-terminal hemopexin-like domain. This domain is ellipsoidal in shape, formed by four β-propeller blades and an α-helix. Each blade consists of four antiparallel β-strands arranged around a funnel-like tunnel that contains two calcium and two chloride ions. The hemopexin domain is important to facilitate the cleavage of triple helical interstitial collagens. .
Sources: en.wikipedia.org
=== Gelatin-based scaffolds === Gelatin is the denatured form of collagen. Gelatin possesses several advantages for tissue-engineering application: they attract fibroblasts, are non-immunogenic, easy to manipulate and boost the formation of epithelium. There are three types of gelatin-based scaffolds:
In most cases symptoms are mild, short-lived, and resolve without treatment. More severe cases are often successfully treated by temporary reintroduction of the drug with a slower tapering-off rate. Sertraline and SSRI antidepressants in general may be associated with bruxism and other movement disorders. Sertraline appears to be associated with microscopic colitis, a rare condition of unknown etiology.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
It is a synthetic cyclic heptapeptide and an analogue of alpha-melanocyte-stimulating hormone. The molecule is produced by chemical synthesis rather than extracted from a biological source.
It is shorter than the native hormone and carries a cyclic constraint that improves stability. These changes raise receptor potency and slow breakdown relative to the naturally occurring peptide.
Published accounts date its development to the 1980s, when researchers were generating analogues of melanocyte-stimulating hormone. That work aimed to produce more stable compounds for studying pigmentation biology.
Dry powder is usually held frozen, shielded from light, and kept away from moisture. Desiccant packaging limits hydrolysis during storage. Solutions are typically aliquoted and frozen once, because repeated thawing shortens useful life.