This is a working overview of certificate of analysis, written for readers who want more than a one-paragraph summary but less than a textbook.
Reviewed 2025-09-26. Anything still debated is marked as such rather than presented as settled.
Published research on the compound remains limited. Much of the human data comes from small, early-stage studies rather than large controlled trials, and several questions about effects and variability between individuals remain open. Investigators have examined receptor activity, pigment pathways, and related physiological responses in laboratory and animal models. Findings from those models do not automatically translate to human outcomes. Reviews frequently note the scarcity of rigorous clinical evidence and call for better-characterized study material.
Because the substance circulates mainly through informal markets, verification is a recurring theme in technical discussion. Independent analyses have found that labeled content and actual content can diverge, and that purity varies between samples. Analytical laboratories use reversed-phase chromatography to separate components and mass spectrometry to confirm identity. Isotope-labeled internal standards improve quantification in complex matrices. Such methods describe what a sample contains but say nothing about its sterility, lawful status, or suitability for any use. Open questions remain about how consistently testing is applied across the supply chain.
Regulatory treatment of this peptide varies by country. It holds no marketing authorization as a medicine in the United States, the European Union, or most other jurisdictions. Some countries classify products containing it as prescription-only or unlicensed medicines, which restricts lawful supply. Authorities have issued public notices warning that unregulated products may contain undeclared or incorrect ingredients. The molecule also appears on prohibited lists for competitive sport. These measures address supply oversight rather than any approved therapeutic role.
Outside regulated medicine, melanotan II circulates through online vendors as a research chemical, often marketed for tanning. Products sold this way vary widely in purity, concentration, and labeling accuracy, and independent testing has documented discrepancies. Published reports describe both pigment effects and adverse reactions, including nausea, flushing, and darkening of existing moles. Long-term safety data are sparse, and no large controlled trial has established a risk profile. Questions about cumulative effects on melanocytes remain unresolved in the literature.
Melanotan II is a synthetic peptide analog modeled on alpha-melanocyte-stimulating hormone, a naturally occurring signaling peptide involved in pigmentation. Its structure is a cyclic heptapeptide containing two non-natural substitutions, norleucine at position four and D-phenylalanine at position seven. These modifications resist enzymatic breakdown and extend the molecule's activity relative to the native hormone. The compound binds melanocortin receptors and is studied mainly as a pharmacological tool rather than a therapeutic product. It has never received approval as a medicine in any major jurisdiction.
| Property | Value | Notes |
|---|---|---|
| Regulatory status | Not approved as a medicine | No marketing authorization in major jurisdictions |
| Scheduling example | Prescription-only supply in some countries | Handled as an unlicensed medicine where restricted |
| Sports classification | Prohibited peptide | Appears on anti-doping prohibited lists |
| Reported presentation | Lyophilized vial | Nominal content varies between vendors |
| Detection approach | Liquid chromatography–tandem mass spectrometry | Used in anti-doping and forensic testing |
Routine characterisation relies on reversed-phase high-performance liquid chromatography with ultraviolet detection near 214 nanometres, using a C18 column and a water-acetonitrile gradient containing trifluoroacetic acid. Electrospray ionisation mass spectrometry confirms the expected molecular mass and can reveal truncated or oxidised by-products that co-elute poorly. Sequence and stereochemistry require additional work, such as peptide mapping or amino acid analysis, because a chromatographic purity figure alone does not distinguish a diastereomer from the target peptide. Independent testing of research-grade material frequently shows measured content below the stated label, so a certificate of analysis is best read together with the method that produced it.
Melanotan-2 is handled in the laboratory as a lyophilised powder that dissolves readily in water, dimethyl sulfoxide and dimethylformamide, with limited solubility in ethanol. Stock solutions prepared in an organic solvent often precipitate when diluted into aqueous buffer, so gradual dilution with mixing is standard practice. The peptide carries a tryptophan residue and a histidine residue, both sensitive to oxidation and to alkaline conditions. Working solutions are therefore kept near neutral to slightly acidic pH, protected from light, and consumed within the same working session whenever that is practical.
Structurally, Melanotan-2 retains the core recognition motif of alpha-melanocyte-stimulating hormone while adding a lactam bridge that links two side chains and constrains the molecule into a ring. This modification lowers susceptibility to enzymatic degradation. The compound acts as an agonist at melanocortin receptors, particularly subtypes associated with melanin production. Because the same receptor family influences several physiological processes, researchers note that its activity is not confined to pigmentation alone. Receptor selectivity continues to be examined in published studies.
Melanotan-2 is a synthetic cyclic heptapeptide designed as an analogue of alpha-melanocyte-stimulating hormone, a naturally occurring peptide involved in pigmentation signalling. Its sequence incorporates modified residues that increase potency and extend biological activity relative to the native hormone. The compound binds receptors of the melanocortin family and is examined mainly in laboratory research. It does not occur naturally and exists only as a manufactured chemical entity produced by solid-phase synthesis.
The peptide was developed during the 1980s by researchers investigating melanocortin signalling and skin pigmentation pathways. Early work focused on analogues of alpha-melanocyte-stimulating hormone that would resist enzymatic breakdown more effectively than the parent molecule. Melanotan-2 emerged from that programme as a shortened, cyclised variant. Reports describing its synthesis and receptor activity later appeared in the scientific literature. Commercial availability grew through unregulated channels rather than through pharmaceutical approval.
Regulatory status differs by country, and in many places supplying the compound for human consumption is unlawful. Vendors frequently label material as intended for research use only, a designation that shifts stated purpose but does not create a legal pathway for personal use. Certificates of analysis accompanying such products vary widely in detail and provenance. Third-party testing exists but is voluntary, and results are rarely linked to a specific lot in a publicly verifiable way.
Identity testing for a synthetic peptide relies on several complementary methods. Reversed-phase high-performance liquid chromatography separates the target from related impurities and reports purity as a percentage of total peak area. Mass spectrometry confirms molecular mass and can reveal deletions or truncations. Amino acid analysis and peptide mapping provide sequence-level confirmation, while counter-ion content and residual solvents are measured separately. A purity figure alone does not establish identity, so a complete dataset combines chromatographic and spectrometric evidence.
Lyophilized peptide powder is generally stored frozen, protected from light and moisture. Tryptophan residues are susceptible to oxidation, and the lactam bridge can hydrolyze under strongly acidic or basic conditions. Solutions prepared for laboratory work degrade faster than dry powder, and repeated freeze-thaw cycles accelerate loss. Common practice is to aliquot solutions before freezing and to avoid alkaline buffers. Reported stability windows vary with concentration, buffer, and temperature, so exact shelf lives are method-specific rather than universal.
The compound emerged from research programs in the 1980s that examined analogues of alpha-melanocyte-stimulating hormone for pigmentation and photoprotection. Investigators modified the native sequence to extend activity duration and potency. A related analogue, afamelanotide, was developed within the same broad line of inquiry and eventually gained approval in certain jurisdictions for a rare light-sensitivity condition. Melanotan-2 itself did not progress through the same regulatory route and has no approved therapeutic indication.
Melanocortin receptors comprise five subtypes with distinct tissue distributions and functions. Melanotan-2 is described in the literature as a non-selective agonist that engages several of these subtypes, including MC1R, MC3R, MC4R, and MC5R. MC1R is the subtype most directly linked to melanin production in skin cells. Because the compound is not subtype-selective, its observed effects in experimental settings are generally attributed to activity across multiple receptor pathways rather than to a single target.
Melanotan-2 is a synthetic linear peptide built from seven amino acids arranged in a short chain. Its sequence is commonly written as Ac-Nle-Asp-His-D-Phe-Arg-Trp-Lys-NH2, which includes a modified N-terminus and an amidated C-terminus. The molecule belongs to the melanocortin family and acts as a receptor agonist. Structural features such as the D-phenylalanine residue and the Nle substitution are associated with increased stability against enzymatic degradation relative to the natural parent peptide.
Somapacitan, sold under the brand name Sogroya, is a growth hormone medication. Somapacitan is a human growth hormone analog. Somapacitan-beco is produced in Escherichia coli by recombinant DNA technology. The most common side effects include: back pain, joint pain, indigestion, a sleep disorder, dizziness, tonsillitis, swelling in the arms or lower legs, vomiting, adrenal insufficiency, hypertension, increase in blood creatine phosphokinase (a type of enzyme), weight increase, and anemia. It was approved for medical use in the United States in August 2020, and in the European Union in March 2021. Somapacitan is the first human growth hormone (hGH) therapy that adults only take once a week by injection under the skin; other FDA-approved hGH formulations for adults with growth hormone deficiency must be administered daily. It contains a small non-covalent moiety that reversibly binds to serum albumin which slows down elimination.
== External links == Labor Management Relations Act (PDF/details) as amended in the GPO Statute Compilations collection A film clip "Longines Chronoscope with Fred A Hartley" is available for viewing at the Internet Archive
With regard to carcinogenicity it has been suggested that methylation should be regarded as a toxification. Arsenic, especially +3 As, binds to single, but with higher affinity to vicinal sulfhydryl groups, thus reacting with a variety of proteins and inhibiting their activity. It was also proposed that binding of arsenite at nonessential sites might contribute to detoxification. Arsenite inhibits members of the disulfide oxidoreductase family like glutathione reductase and thioredoxin reductase. The remaining unbound arsenic (≤ 10%) accumulates in cells, which over time may lead to skin, bladder, kidney, liver, lung, and prostate cancers. Other forms of arsenic toxicity in humans have been observed in blood, bone marrow, cardiac, central nervous system, gastrointestinal, gonadal, kidney, liver, pancreatic, and skin tissues. The acute minimal lethal dose of arsenic in adults is estimated to be 70 to 200 mg or 1 mg/kg/day.
=== 1998–2001: Early roles and breakthrough === Chase made her television debut in 1998, appearing in a minor guest role on Sabrina the Teenage Witch. She appeared in the 1999 television film Michael Landon, the Father I Knew, portraying a young Shawna Landon. Over the next two years, she secured a succession of episodic roles in Charmed, The Practice, ER and Family Law. Chase and her mother subsequently maintained a dual residency arrangement, splitting their time between their family home in Oregon and a temporary apartment in Los Angeles to accommodate her filming schedules. In 2001, Chase secured her breakout role portraying Samantha Darko, the younger sister of the titular character (played by Jake Gyllenhaal), in the independent psychological thriller Donnie Darko. Although the film underperformed during its initial theatrical release, it quickly garnered a devoted cult following and received widespread critical acclaim.
=== Bacteria === Necrotizing fasciitis is classified into four groups based on the type of bacteria causing the infection. This classification system was first described by Giuliano and his colleagues in 1977. Type I infection: This is the most common type of infection, and accounts for 70–80% of cases. It is caused by a mixture of bacterial types, usually in the abdominal or groin areas. These bacterial species include:
Sources: en.wikipedia.org
The techniques were later expanded to the meat-packing industry. From 1929, Clarence Birdseye introduced "flash freezing" to the American public. Birdseye first became interested in food freezing during fur-trapping expeditions to Labrador in 1912 and 1916, where he saw the natives use natural freezing to preserve foods. A 1920s hunting trip to Canada, where he witnessed the traditional methods of the indigenous Inuit, directly inspired Birdseye's food preserving method. The Icelandic Fisheries Commission was created in 1934 to initiate innovation in the industry, and encouraged fishermen to start quick-freezing their catch. Íshúsfélag Ísfirðinga, one of the first frozen fish companies, was formed in Ísafjörður, Iceland, by a merger in 1937. More advanced attempts include food frozen for Eleanor Roosevelt on her trip to Russia. Other experiments involving orange juice, ice cream and vegetables were conducted by the military near the end of World War II.
Other methods that determine water content of a sample include chemical titrations (for example the Karl Fischer titration), determining mass loss on heating (perhaps in the presence of an inert gas), or after freeze drying. In the food industry the Dean-Stark method is also commonly used. From the Annual Book of ASTM (American Society for Testing and Materials) Standards, the total evaporable moisture content in Aggregate (C 566) can be calculated with the formula:
==== AP1 ==== Activation of AP1 factor involves three MAPK signaling pathways. These pathways use a phosphorylation cascade of three successive acting protein kinases to transmit a signal. The three MAPK pathways in T cells involve kinases of different specificities belonging to each of the MAP3K, MAP2K, MAPK families. Initial activation is done by the GTPase Ras or Rac which phosphorylate the MAP3K. A cascade involving the enzymes Raf, MEK1, ERK results in the phosphorylation of Jun, conformational change allows Jun to bind to Fos and hence AP-1 to form. AP-1 then acts as transcription factor. Raf is activated via the second messenger DAG, SOS, and Ras. DAG recruits among other proteins the RAS guanyl nucleotide-releasing protein (RasGRP), a guanine nucleotide exchange factor (GEF), to the membrane. RasGRP activates the small GTPase Ras by exchanging guanosine diphosphate (GDP) bound to Ras against guanosine triphosphate (GTP). Ras can also be activated by the guanine nucleotide exchange factor SOS which binds to the LAT signalosome. Ras then initiates the MAPK cascade. The second MAPK cascade with MEKK1, JNKK, JNK induces protein expression of Jun. Another cascade, also involving MEKK1 as MAPK3, but then activating MKK3 /6 and p38 induces Fos transcription. Activation of MEKK1, additionally to being activated by Ras, involves Slp-76 recruiting the GEF Vav to the LAT signalosome, which then activates the GTPase Rac. Rac and Ras activate MEKK1 and thereby initiate the MAPK cascade.
Nuclear DNA has two copies per cell (except for sperm and egg cells), one copy being inherited from the father and the other from the mother. Mitochondrial DNA, however, is inherited from the mother only (with some exceptions) and each mitochondrion typically contains between 2 and 10 mtDNA copies. During cell division the mitochondria segregate randomly between the two new cells. Those mitochondria make more copies, normally reaching 500 mitochondria per cell. As mtDNA is copied when mitochondria proliferate, they can accumulate random mutations, a phenomenon called heteroplasmy. If only a few of the mtDNA copies inherited from the mother are defective, mitochondrial division may cause most of the defective copies to end up in just one of the new mitochondria (for more detailed inheritance patterns, see human mitochondrial genetics). Mitochondrial disease may become clinically apparent once the number of affected mitochondria reaches a certain level; this phenomenon is called "threshold expression". Mitochondria possess many of the same DNA repair pathways as nuclei do—but not all of them; therefore, mutations occur more frequently in mitochondrial DNA than in nuclear DNA (see Mutation rate). This means that mitochondrial DNA disorders may occur spontaneously and relatively often. Defects in enzymes that control mitochondrial DNA replication (all of which are encoded for by genes in the nuclear DNA) may also cause mitochondrial DNA mutations. Most mitochondrial function and biogenesis is controlled by nuclear DNA.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Sources: en.wikipedia.org
=== Approaches === Psychiatric illnesses can be conceptualised in several different ways. The biomedical approach examines signs and symptoms and compares them with diagnostic criteria. Mental illness can be assessed, conversely, through a narrative which tries to incorporate symptoms into a meaningful life history and to frame them as responses to external conditions. For example, the Power Threat Meaning Framework (PTMF) is a conceptual approach to understanding mental distress that serves as an alternative to traditional psychiatric diagnostic systems. Rather than viewing distress primarily as a symptom of an underlying mental disorder, the framework emphasizes the role of adversity, trauma, social inequalities, relationships, and cultural contexts in shaping people's experiences, and proposes that many forms of distress can be understood as meaningful responses to difficult circumstances. Both approaches are considered important in the field of psychiatry, but have not sufficiently reconciled to settle controversy over either the selection of a psychiatric paradigm or the specification of psychopathology. The biopsychosocial model is used to explain the multifactorial origins of clinical impairment, recognizing that biological, psychological, and social factors all play a role in health and disease. Once a medical professional diagnoses a patient there are numerous ways that they could choose to treat the patient. Often psychiatrists will develop a treatment strategy that incorporates different facets of different approaches into one.
== Legacy == The name continues in use as a geographical and cultural term, and it survives in Cumberland sausages; HMS Cumberland; the Cumberland Fell Runners Club; the Cumberland Athletics Club; and various organisations and companies, such as the local newspapers The Cumberland News, and The West Cumberland Times and Star, and the Cumberland Building Society. It is also mentioned in Macbeth as the kingdom given to Prince Malcolm, and is also the initial setting for the Geoffrey Trease historical novel Cue for Treason. In June 1994, during the 1990s UK local government reform, the Local Government Commission published draft recommendations, suggesting as one option a North Cumbria unitary authority (also including Appleby, the historic county town of Westmorland). It also suggested that Cumberland could be reinstated as an independent ceremonial county. The final recommendations, published in October 1994, did not include such recommendations, apparently due to lack of expression of support for the proposal to the commission. The Grass-of-Parnassus was the county flower. It had been associated with the county since 1951, when it was included in the coat of arms granted to the Cumberland County Council. It subsequently featured in the arms granted to Cumbria County Council and Copeland Borough Council, in both cases to represent Cumberland. The flower was also attributed to Cumbria in 2002 as part of a national County flowers of the United Kingdom campaign by the charity Plantlife.
=== Elimination === Severe cases require hemodialysis, which is the most rapid method of removing potassium from the body. These are typically used if the underlying cause cannot be corrected swiftly while temporising measures are instituted or there is no response to these measures. Loop diuretics (furosemide, bumetanide, torasemide) and thiazide diuretics (e.g., chlortalidone, hydrochlorothiazide, or chlorothiazide) can increase kidney potassium excretion in people with intact kidney function. Potassium can bind to a number of agents in the gastrointestinal tract. Sodium polystyrene sulfonate (Kayexalate) was approved for this use decades ago, and can be given by mouth or rectally. Sodium polystyrene sulfonate given with sorbitol was uncommonly but convincingly associated with colonic necrosis; this combination is no longer used. Patiromer is taken by mouth and works by binding free potassium ions in the gastrointestinal tract and releasing calcium ions for exchange, thus lowering the amount of potassium available for absorption into the bloodstream and increasing the amount lost via the feces. The net effect is a reduction of potassium levels in the blood serum. Sodium zirconium cyclosilicate is a medication that binds potassium in the gastrointestinal tract in exchange for sodium and hydrogen ions. Onset of effects occurs in one to six hours. It is taken by mouth.
=== Death of Asa Gilbert Eddy === Eddy's husband, Asa Gilbert Eddy, died of heart disease on June 4, 1882, shortly after the move to Boston. She invited the Boston Globe to her home on the day of his death to allege that he had been killed by malicious animal magnetism, courtesy of "certain parties here in Boston, who had sworn to injure them." The Globe wrote:
The industrial manufacture of silicone breast prostheses employs the metallic element platinum (Pt, 78) as a catalyst for chemically transforming liquid silicone oil into viscous silicone gel, the elastomer material for making breast-implant shells. Occasionally, trace quantities of platinum leak from a prosthetic breast into the woman's body and accumulate in the bone marrow, from where red blood cells would deposit the trace-platinum upon nerve endings and consequently cause disorders of the nervous system, such as blindness, deafness, and nervous tics (involuntary muscle contractions). The FDA's review of the trace-platinum-toxicity data about the silicone-gel used for making prosthetic breasts said that the type of platinum used in modern silicone breast implants is not ionized platinum, and so not a biological risk to women with such prosthetic breasts. That there were no reports of trace-platinum-toxicity and no causal relation between the metal in the silicone-gel and the occurrence of trace-platinum-toxicity among women with silicone-gel prosthetic breasts.
Sources: en.wikipedia.org
Only a small number of early-stage human studies have been reported, and most were limited in size and duration. No large late-stage program has established a general efficacy or safety profile. The evidence base is therefore thin compared with approved medicines.
The peptide is listed as prohibited in competitive sport, so laboratories develop detection methods and monitor for its presence. Its appearance in enforcement reports reflects that classification rather than any approved athletic use. Analytical work in this area focuses on identifying the molecule and its breakdown products in biological samples.
Chromatographic separation combined with mass spectrometry identifies the peptide and estimates its amount in a sample. Testing can confirm whether the expected molecule is present and at what concentration. It cannot establish how a product was manufactured or whether it meets any purity standard.
It is a synthetic cyclic peptide designed as an analog of alpha-melanocyte-stimulating hormone. It acts on melanocortin receptors and is best known from research into pigmentation. It is not an approved pharmaceutical product.